Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec10f01
Contig Information
Length 736 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec10f01   
Homology (BLAST) Top Hit hypothetical protein OsI_22945 [Oryza sativa Indica Group]
Score 699
Evalue 7.53448e-72
Total Hit Count 173
Registered year 2003
Contig Sequence     [ Download ]
>whec10f01
CGGTTCCCCTGCTGAGCTCCCGATCTCTGCTCCGAGGCGTCGGCAATGGAGGTGCTCTGCATCGGGACGGCCGACACCAAGCTGGAGGAGCTGCTCTTCC
TCGCCACTCGCCTCCGCTCCAGCCTCGCCGCCTCCGTCTCCGCCTCCGCCCCAAAGGTTAAAGTAAGCATAGTGGATGTCTCCACAACTAAAACAGTACC
AACACAAGATTCTAAAGATATTGCAGTTATTGCAAGAGATACAGTTCTCTCATGCCATCCGGATTCCAGCCAGCAAGATCTTCCAGATGACAGAGGTGAA
GCGATTGCGCTTATGTCAAAGGCCCTTCAGAGCTTTCTGAAAAACAGATATGAGGCCGGCACCCTGGTTGCTGCTGTTGGCCTAGGAGGAAGTGGAGGAA
CCGCACTAATTGCCCCTGCTCTAAGATCCCTACCACTTGGAGTGCCTAAGCTTATTGTATCCACTGTTGCTAGTGGCAATACTGCACCCTATGTTGGAAC
ATCTGACTTGGTATTGTTTCCTTCAGTTGTTGACATATGTGGAATAAACAGTGTCAGCCGTGTTATATTGTCGAATGCTGCTTCAGCTGTTGCCGGATTG
GTATGTGGGATATTAATGGCTTCCAGTGAATCAGATGAAACAGACACAAAGCTGACTGTTGGAATTACAATGTTTGGTGTTACCACACAATGTGCAAATG
CGGTCAAAGATAGACTGAACAAAGAAGGGTATGAGA
page-top