Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec10e15
Contig Information
Length 753 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec10e15   
Homology (BLAST) Top Hit conserved hypothetical protein [Culex quinquefasciatus] >gi|167875108|gb|EDS38491.1| conserved hypothetical protein [Culex quinquefasciatus]
Score 130
Evalue 7.40132e-06
Total Hit Count 68
Registered year 2003
Contig Sequence     [ Download ]
>whec10e15
GTATTGTAATATTCACGTTTCATATAAGCAAGTATCATCTAAACATATTGCCAACAATTCCTGCAGCAACGCGCGGGGAATTGTTTAGTTTTTACAATAC
ATGGTTAACATTCTTTCTATACACATTTAATATTTTTGAAATGCTTGGTTAACATTTTTAAATACTTGTTTAGCATTTTTTCAAATGGTGGATTAACATT
TTTATATACACGATCAATAAAATTCGTCATTTTTAATACATGGTCAAAAAAAATTATACACACATTTAACATTTTTCAAATGCTTGATTAATATTTTTCA
AATACTTGTTCAACATCTTTTTTGAATGCTTGATTAATATTTTTATATACATGATCAAGTTTTTGTTGAAATACTTGTTCAACATTCTTGAAATACTATT
TCAACATTTTTCAAATACTTGTTCAACATGTTTCAAATGCTTTTTGTAGACTGTCTTTTATATACATGATCAAAATTTATTGAAATACCGGTTCAACCTT
TTTCAAATACTTTTTAAACATTTTCAAATACTTGTTCTACATATTTTATTTTGAATGCTTGATTAACATTTTTCTATACATGATCAACATTTTTAAATAC
TTGTTCAACATTTTTAAATAATTATTCAACATGTTTCAAATGTTTTTGTAGACTTTTTGTAATATATATATATATATGTGTATTTAAAATATTTGAAAGT
ATAAACAAAAGTACAAAAATAAAGCAAAAAACGAAATCAGAAAACCTAAAAAA
page-top