Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec12m23
Contig Information
Length 715 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec12m23   
Homology (BLAST) Top Hit zinc finger protein 511 [Zea mays]
Score 642
Evalue 2.87779e-65
Total Hit Count 105
Registered year 2003
Contig Sequence     [ Download ]
>whec12m23
TGATCATATTGATCATGATACAAATATAGTGCAAACTTCAAACGTCCAAGTACAAGGGAAATCCGTATTAGAGATTGATAATCCGTTGAAGAATTGTCAA
TTTGCTTCTGGCTGAGAGACCTGCTTGTTCTGCCTAATAGATCTTGGGACAAAAGTAAGACCACGAGCACGACGATGGCCAAAGGTTATGCTCGAAGGCA
CCGAATCTGCAGTACTCAGCCTTGATACAGCAAAGGAGAGTTCATCAATCTTCTGTTCGACCTCCATGTCGCTCTCCTTGGCCTCCTTCTCGTGATGTTC
ATTTTCTTTCGACTCCTTATGATCATGTTCTTTTTCTTTCGACTCCTTGTGGTCGTGTTGCTTCGGCCGATATCTCGATTTTGATTGCCTTGGATTCTTT
CCATCAACGTCCATGACAGTATCCCTTGTCTCTTCCCCCTTATAAGCAGTTTGCCTTCGATGATGATACTTCTGACGATGCCGCTGGGAAGGTTGTGCCC
TTTTGAAGAATTCAAATGAGTTGGGAAATTGATGCTTATCAACAAGATGCTGCTGCCGACTTTTGTACGTCTTCAACTTCTCCCCACAACCCTCCACCAA
ACATTCATACATCGGAAAACCACGAGCGACTTTTGCTTGGAAGAAGGAATCATGCGCCTCAGAAATATGAATACTCAGCAACCTTGATGTTGGGTACACT
CTTGAACATACAGAG
page-top