Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec12m21
Contig Information
Length 701 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec12m21   
Homology (BLAST) Top Hit Zn-finger, RanBP-type, containing protein [Zea mays]
Score 449
Evalue 6.57514e-43
Total Hit Count 236
Registered year 2003
Contig Sequence     [ Download ]
>whec12m21
CCATCCTATGTATAGTGGACTTGTTCATTTCAGAACATTGCAAATGTCATCACAGTTGAGGAAACAGTACGGGTAGTTTAATATTACAGGCTTGACCTGC
ACCGTCTTAACTAGATTTTTCTTTCCAGAGCATCAGTTCCAAGGATGAACTAGTACCGTCCATCATCCCTACCATGAAGAGCAGCGCGCCGATCATCTCG
ACCCTCGCCGGGGTATGGATCACCTCCTGGCCTGTAAACACGGCCACGCCCACGTCCACGCCCGCGCCCAGCATCCAACCGCCCCCGGCCTACATATGAA
CCACCATACTCTAGGTCTGGTCGACCTCTGCCCAAGAAAGCACCCTTCATTGGTCTGTTACCTGCAGGAGATCTGCTTCTGTCCCGCATATCGCTCCCCC
AGCTCCCCTGAGGAGATCGGCTCCTGTCAAGATACAACCCACCATGTGGACGCTCCCTCTGCTTGTACTCCGCAGCAGACCACTCAAACTTCACAGGGTC
ACGCAACTCACGTTCACCACGGAAACCCCTTTCACTCTGCAACGGATCTGGAAATCGTCCTACACGATCTGGAGGCGATCTAGCTGGATAACTTCTAGGA
TCACCCACACCCCAATCACGGGGTGCTGGCTTGTACCTGGCCATTTCTCTTGGAGGGGCACGATCACTTGGTGGACCAAGCGGCCTTGCAGGCACTCGTG
G
page-top