Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec1o07
Contig Information
Length 766 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec1o07   
Homology (BLAST) Top Hit hypothetical protein OsI_06018 [Oryza sativa Indica Group]
Score 89
Evalue 0.438081
Total Hit Count 7
Registered year 2003
Contig Sequence     [ Download ]
>rwhec1o07
ATAATANTAGAAAACTACATAAATANAAATGTTCTATGCCACCAGCTTCAGACCAAATCTTAACATANTGAATGCGTCTAGCCTCAAGCAATCGTCAACT
TGATGAAATGGCAAAGTTCACGCGCCTTGGCTAATCACCTCTATATTTTTCTTCAGGTCCCTTCTGCAGTATCATAAACAAATCCTTTCACTGAGAAATA
GCAGGTGACACACATAGATAGCTCTAGTTCCGAAACTGCTCCATGGACGATACTGGTGCCCGACGTGTGCACGATACGTAAATCCAACGTCCTGTGTTGT
TTCACTCATATGCATGTACGGCCTGATTTAATCATCGGCTGTGAATCGTCCTGATTTTATCGTGTGCATAGCATGACTCCTCTAGTTCTTTCTCTCTTGA
CTCAAAGTTAGATAAACTACGGAAACGTTCACAAGTTCCCTTGGGTATAACATTGTGTTCTTCAGCTGTCTTCATTTTCTATTTGAGAAAAGACGTATAA
AGCTCGATTTCTCTTGGGAACAGCTTATCGATCTCATTACAGATACGCCTTTTGTAAGTGCCATCTTTGATGCTTTTCTTTGGAGGAGACTTACCACCAG
TAAGTTCTTTAAGACGTTCGACCGTGTCTTGTACAGTATATTCACAATCCTCCAACTCTAGAGCAGCAAACTCGGTAAGATCATAGAATAAACGAACTCT
TCCTTCTTGGATGTGCTTGAAAATAGCTTTACGCTCCTTTTTCTCAATTANCCTCTTCATGCNCAA
page-top