Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec3o09
Contig Information
Length 540 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec3o09   
Homology (BLAST) Top Hit hypothetical protein OsI_20851 [Oryza sativa Indica Group]
Score 292
Evalue 5.71419e-25
Total Hit Count 52
Registered year 2003
Contig Sequence     [ Download ]
>rwhec3o09
CAGCCCAATATACAAACAGATATACAGCTAGCCTTCTTTTCCCATACACAAATTACATGCATTTACACTCACGACATATACNTAAATATGTACNAAGGGT
TAGCTCTGCGCACGGANAGCATGATCGNGGCGACCAATCAATTCCAGNATTTACGCACCAACAGCTCCGCCGATGAAGNGCCTCCCTCCCCCCATCGTCG
TCTAAGCTCCTCAAAAGCAAAGTTTCTTCTTGCGGAACTTGAGCATGTCTNGCTNGTCNATGAANGCNAGCAGCTCGTCCNGACGCATCAGCGCCTCGNA
AAGGGCCTTCTTTGNAAAAATCAAGTCGGNTTCCAAGGNGTCCACACGGNGGGNGGACGCATTGAGCAGCTCCTCCTTCTCNAANGGCATCTCGGANGGN
TTTTTTTCAAGCGCCNGCACCTTCTCCTCCAGNTCACCTAGCCGTCTTACCAAAGTTGAAAGGATTTCCTTCTCCGNGTAGGCCGGGGCAGGANACGGAG
GTCGGAACTCCTCCTTGTACTCTNGCTCTTGAGGGCAGTC
page-top