Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec16f21
Contig Information
Length 150 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec16f21   
Homology (BLAST) Top Hit Os10g0321700 [Oryza sativa (japonica cultivar-group)] >gi|110288867|gb|ABG66004.1| RNA recognition motif family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113638950|dbj|BAF26255.1| Os10g0321700 [Oryza sativa (japonica cultivar-group)]
Score 76
Evalue 1.07836
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>whec16f21
ACCGGAAATGGATGGGAAGGATTTGCAGGGCTCGGATAGTGAGGGTGAGCTATGCTCATGACCGTGGTAGTCGTCCAAGTTTTGGTGGTGGGGGTGGCTA
TGGCGGCGGCGGCGGTGGCGGCTATGGCGGCGGTGACGGTGGTTACAGTG
page-top