Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec10b08
Contig Information
Length 697 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec10b08   
Homology (BLAST) Top Hit protein phosphatase 2C [Triticum monococcum]
Score 676
Evalue 3.10079e-69
Total Hit Count 210
Registered year 2003
Contig Sequence     [ Download ]
>whec10b08
GGCGGCTTCTGCGGCCACCGTCGAGGCGGAGGCGAGGGTCGCGGCCGGGGGGAGGAGCGTCTTCGCTGTCGAATGCGTTCCACTCTGGGGGTTTACATCA
ATTTGCGGCCGCCGCCCGGAGATGGAGGATGCGGTCATCGCTGTGCCGCGATTCTTCGGCTTGCCCCTCTGGATGCTCACGGGCAACAATATGGTCGATG
GACTCGATCCCATCTCCTTCCGCCTCCCCGCGCACTTTTTTGGTGTATATGATGGCCACGGCGGTGCACAGGTAACCCCACCATTAATGACACCTATCAA
CTGCCTACTGTATGACCTTGCCAGTCTCTGCCTCAATCCCAAGTGAAACTACAACTTTGTTAGATTTTGCGTCATGCCTGTGCAGGTAGCAGATTACTGT
CGGGATCGGCTCCACGCAGCGCTGGTGGAGGAGCTGAGCAGGATAGAAGGGTCCGTGTCTGGTGCTAGCCTGGGAGCTGTGGAGTTCAAGAAGCAGTGGG
AGAAGGCGTTTGTGGATTGCTTCTCAAGGGTGGATGATGAGATAGCCGGTAAGGTGACCAGCGGAGGAGGGGGAAACGTGGGCACAANCAGTGTCACTGC
AATGGGCATGGTANATCCTGTANCACCCGANACCGTCGGTTCAACGGCGGTGGTCNCTGTCATCTGCTCCTCTCATATCATTGTCTCAAATTGTGGA
page-top