Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec10c09
Contig Information
Length 335 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec10c09   
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195639356|gb|ACG39146.1| transaldolase 2 [Zea mays] (no hit)
Score 1115
Evalue 4.12682e-120
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>whec10c09
ATTNATTTNATNANGAGTTTGAATTTTTANGAGAACACCTCATGTTCAACCACTTTCATTTCCCTTCATTCTTAGTTTCTTACTAATGGTCGCTCGATGG
TGCTAATTGGCTTATGTGGTTATANATGGTGAGTATTACAGTATTANGAAGGCTCGCATCACCATTATTTTAAGGAAGTTTAATCCATGTATGTTTTGGC
CATGTAATTTGAAATTCTTANCTGCATGGAAGNGGTACCTTTTANTTCTTTGTGCTGCTTACNAAAATAATCATCATTGGGCTGTAAATTTGACTGCNCA
ACCTANGCTGATTTTCNGNATTTTTCTTCNNGGNA
page-top