Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec10b15
Contig Information
Length 696 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec10b15   
Homology (BLAST) Top Hit hypothetical protein OsI_36458 [Oryza sativa Indica Group]
Score 450
Evalue 4.98505e-43
Total Hit Count 77
Registered year 2003
Contig Sequence     [ Download ]
>whec10b15
GCGGCGGCACGCGGCGGCGCAGCTTGTTTCAAGGTCGGCACATCCTGCAGGCCAGTTGAAGTCGGCCTACCACCCCTGGACCAGCCCAAAGCCGAGTCAC
GGCCGCACCGCAACTCGCCAGCTTCCGCGCACCAGCTGCGCCGCCCTCGCCAGGCAGCGATATCTCCTATCTCTCCTGCCGGCGGGTCGGTGGTTCCAGC
GGACAAGATGCTGGGCGTCTCCACCAGCCAGCTTTTGGTCATCCTCGGGGCCTGCTCCGTGATGATGAAGCCCAGTGACATGATCAAGATGGCAAGGGTG
GCAGGGAGGATGACCGGGAGAGCGGTCGGTCGCCTCATGCTCTACCGCCGGCAGATGGACGACATCTTCGAGCAGACTGCAGCGAAGAAGATTAATACGG
AGCTTCAAGATGCCATGTCAAAGTTACAATCAATTGGTTATGAAGTTCAGAACTTATCTANAATAACTCCTGGCCAGTTTATCAAAAGGCAGCACAACAC
CGAGGGCATGACTGAAGCAGGAACATATGATGGTTCTGCAACTCANTCTGGAGAATTTCNTGATGATATTCNCANTATAATTCNTGATGAAATTGANAGC
TTTTGTANAAAAAATCCTGATCAATTTACCANGANATTAAATAATTCTGACGGAATTCANAACTCTGAAAAACCANCTGAANCTACAAAATTTGAT
page-top