Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig2070
Contig Information
Length 788 bp
Tissue Callus
Clones 10 Clones [Download: CSV  ,  FASTA ]
whcs13f02    whcs13f13    whcs14e02    rwhcs13f02    rwhcs13f13    rwhcs14e02    rwhcs17m05    rwhcs17m06    rwhcs1o12    rwhcs1o23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Vitis vinifera]
Score 681
Evalue 1.04537e-69
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig2070
TTTTTTTTTTAATGGTTCACACAATCACTAATTCTCAGACATAAAATGCAAGGTTCAGATAAGCACCCACCAGGTGGATGATTTAGGACGACCAACGAAC
AAATGATCCAGCTCTACCAACATAGTATGGCACAGAGTACGGCACTGACATATTACTACACACGACAAGTATTAGTAGTTCACGACACATGATAAGCGTT
CAGCTGCAAAAGCAGACACAGATGCCCGCCAGAGCCATTCCCACAGGGAAAGCAAGCATCTTAAGCCCTCTCGCCACGGATCCTCCTAGCCAGCTGAATG
TCCTTGGGCATGATGGTCACCCGCTTGGCATGGATGGCGCACAGGTTGGTGTCCTCGAAGAGACCCACCAGGTAGGCCTCTGCAGCCTCCTGAAGGGCCA
GCACCGCATGGCTCTGGAAGCGGAGGTCAGTCTTGAAGTCCTGGGCAATCTCCCTAACAAGCCTCTGGAATGGAAGCTTCCTGATGAGCAGCTCCGTGCT
CTTCTGGTACTTGCGGATCTCACGAAGAGCAACAGTTCCAGGGCGGTAACGGTGAGGCTTCTTCACTCCTCCAGTAGTGGGAGCAGACTTACGGGCAGCC
TTGGTGGCTAGCTGCTTCCTTGGAGCCTTTCCTCCAGTGGACTTACGAGCGGTCTGCTTAGTACGAGCCATGAGCAAAACCTTGGTTTACCTCGCGCGCC
TCAGAAACCCCAAATTCGCCGAGAGGGAGAGGTTGCAACTTTCAGGAGACTCGGAGAGCGGCGGTTGGAAGAGAGAGAGAGAACTAGT
page-top