Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem19c16
Contig Information
Length 673 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem19c16   
Homology (BLAST) Top Hit multi-sensor signal transduction histidine kinase [Magnetococcus sp. MC-1] >gi|117609978|gb|ABK45433.1| multi-sensor signal transduction histidine kinase [Magnetococcus sp. MC-1]
Score 77
Evalue 8.32396
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>whem19c16
AAGCGTCCCAAAAAAATCTCTTACCACAGAAGCATTATTCCCAGGTGGTAGATTTCCAGACCGCGTCCCTTGAAGCACGAACTAACCAAACCAAGCTACA
AGTGTGGAGTGCTCCAGATGCAGGATCCGAAACAGCCTGTGAAAATTTGAACGATATATGCTAGGACCTTATGGCGAACGCATATTCGTAAAAGATGACC
AATACCCACCCGGCTTCACGCTAGAAAATCGATTGCAAATGCTGAAATGCATGCAAGGACAAGAAGGCCGTTTGATTATCAAACTCATTTCCAAGAATAA
ATAAATGCATTCCTTCTAACTCTGCGTGTGCCTAATTTTCGTTAAGTAAAAGTATCTGTTATGCACAACCACTATCTGATAAAGTCTTACAATACCTATT
ATTTTCTAACTCAAAATAGGAAAAATGCCGAATGGTCTCTCCAAAAATACAGCCAGTAAATGTTTGTACGTTTAATTTAGCATGGGTATTTCGGAGTGCA
CGCGTCCTTGTGTGGGGCATGCATGCAAGCACTATTCTATGGATGGACACCTCCCTCTCTAGAAGGCCCACTTTTTTTTATATATATTTAGGTAACGCTT
GCCTATTTTGTAAGCCGACACGTAGCAAGTATGTGTCTCTTTGATGGGGCATCCTGTTAATCTCTCCTACTGC
page-top