Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig2055
Contig Information
Length 872 bp
Tissue Callus
Clones 9 Clones [Download: CSV  ,  FASTA ]
whcs10e23    whcs14g02    whcs14g13    whcs2m17    rwhcs10e23    rwhcs14g02    rwhcs14g13    rwhcs19i19    rwhcs2m17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L10A [Triticum aestivum]
Score 994
Evalue 6.30834e-106
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig2055
TTTTTTTCTGTTCAAGATAAGACTAGTACGATTAAATACTTGTTGATATTCGCTTAGGCAAACACAAAATTGGTATCAGTGAAACAGATCTAATCCAAAG
ACAAGCAGGGGTCGGCAGGAAAGCCCGGTATCTTATCAACTTCACTGGAGCGCACACACTTAGAACACCCGTACACGCTTCCCCATGGTGCTCTTCACGT
ACAGGCACCTCACATTCTGCCAATTCTTCTTCAGGAGGGACACAAGGAAGTTGACACTCATTTGGATGTTTTGTTGGATCTGCTTCTCGTCCATCGACAA
GTTGCCCACAGCAACACCCATGCAAAGAACCTTCTTTAGCTGGAACTTGACTGTAGCTTTTGTCTCGTTGACCTTGGCTTCAAGAGATTCCTGGTGACTA
ACCAGAGTGGGAAACTTGCCTGCCTTGTTAAGACCAGGGCCAAGGAGACGAGGGATCTGCTTGATTATGGCCTCTGATGCCAAGAAAGCATGGTACTTCT
TGGCTAGCTTCTTAACAAGCTTCTTGTTCTTGTTCATCTTCTTGAGACTTTCAACATCCATGTAGTCAAGTCCCATTTTCTCAGCCTGGTCGACATGCTG
GGCATCACCAAGCATGCACACCCTCATCTTTGGGCGGGGGATATGGGGCAGCTTCACTGAGCCGCTGAAACGTTTGTCCTTTTGTGGGTCGTAGTTTTTG
AGACCGATCTGAAGCTCCACAGTCTCAGTGAACTTGCGCTTCTTTTCTCTCGCCTCCCCAACAATCTGGGTGATGGCATCCTTAACAGCGTCACTTTGGA
GCTTACTCATGGCTGCCGCCGATCAGTTGACGCCGGCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCC
page-top