Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig2040
Contig Information
Length 595 bp
Tissue Callus
Clones 8 Clones [Download: CSV  ,  FASTA ]
whcs3i19    whcs5o23    whcs14a15    whcs15d12    rwhcs3i19    rwhcs5o23    rwhcs14a15    rwhcs15d12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein P1 [Triticum aestivum]
Score 305
Evalue 2.28152e-26
Total Hit Count 341
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig2040
GCCTCCTGCGCCTCCACTTCCATCGCCTCCCAAGATCGCAGATCTGCTCCGGTGAGAATCCGTCGCCATGTCTTCCAGCGAGGTCGCCTGCACCCTTGCC
GCCCTCATCCTCCACGATGACGGGATCCCCATCACTTCTGAGAAGATCGCGACGGTGGTGAAGGCTGCCGGAATCAAGGTTGAGGCCTACTGGCCCGCGC
TCTTCGCCAAGCTCCTGGAGAAGAGGAGCGTCGATGACCTCATCCTTTCCGTCGGATCTGGTGGAGGTGGTGCTCCAGCTGCTGCTGCTGCTGCCCCGGC
TGCTGGTGGTGCTGCTGCCGCTGAAGAGAAGAAAGAAGAGAAAAAGGAGGAGGCTAAGGAAGAGAGCGATGATGACATGGGCTTCAGCTTGTTCGACTAA
GCAGTTCAATTCCAGTTCTCCTGTGGAATCTTTTATGCTAAGGATTACTTATCTTATGTGCTTTTAGGTCGAATTTTGCGGATTTAATATGTTTGAGACC
TAAGTATCTGTGCAATGAGTACTGCAAACCACCTTGGGATGGTCTTTTTAGAATGAAAATGGTTTTGGTGCTTGGTTGAAAAGCCAAAAAAAAAA
page-top