Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig2023
Contig Information
Length 790 bp
Tissue Callus
Clones 8 Clones [Download: CSV  ,  FASTA ]
whcs10f04    whcs10g20    whcs8k24    whcs13e19    rwhcs10f04    rwhcs10g20    rwhcs8k24    rwhcs13e19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit transport protein [Stigmatella aurantiaca DW4/3-1] >gi|115368317|gb|EAU67274.1| transport protein [Stigmatella aurantiaca DW4/3-1]
Score 91
Evalue 0.273531
Total Hit Count 15
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig2023
AGCGACTCCACACCAGCCCCCGTTGAGAGTCGAGAGAGTTCCACCGCTCCCGGCCCGATCCCTTATCTTCTCCGACGGCCTCGCCGGCCGGAGCGGAGAC
GGGAGAGGTGCATGGCGTTGTCCTATGTATATAGAATCTAGGTATAGGTTGAGGTCGAGTAGTGCCCATGTGGCGTATGGCTGTATGCCGATGTGGAGAG
CGCCGCCGCCGCGTACGAGCAGCGGCTGGTGGCTCACGGTGGCTGCGTCTCAGGCAAGGCTGGCTGGCGGCCAGTCGCTGCCGAGGGGCGTGCTGCTGGC
TCATCCACCAATAAGCTCGTCTGGTCCCCTGTTCTGGAGGCTCTCCGCTACTTCTCTAGCTCGTGGCGTCGCCGTGGTGGTGAAGACGAAGAGTAGAAGA
GATGGAGAACCAGATCGGGTCAGTGCTCTTATCCGGTGGCTGTTTGGGAGTGGCCTTGGCGCCAGCTACGGCGTTCGGCGGCCGGCCGGCTCCATCACGT
CATCGTACATGCTGGCCGAAGGGCGGCCTTTCTACTTCTTCCTCCCGGCCAAGATGCCTAAAGGGAGGCAGCTCATCTTCTGCACGGAGTCTATGGCGTG
GTGCCATGGAAGCTTAGTTGTCCCAAGTGGCAATGTCCCCGGCGACGGCGAAGTTACGGCCGTGCAGAAGATGTCAAGGACCCGATTGCTTTTCTTATCT
GGTTATTGGGGTCCTCTTTGTAAAAGACAGGGACCAGTGTGTTATTTGCAGTTAGTTCTGGGTCCGTCTGTAAAATGCTGTGTACTTCAT
page-top