Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig2012
Contig Information
Length 992 bp
Tissue Callus
Clones 8 Clones [Download: CSV  ,  FASTA ]
whcs10e05    whcs10i17    whcs19g03    whcs19i08    rwhcs10e05    rwhcs16k21    rwhcs19g03    rwhcs19i08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 40S ribosomal protein S9 [Zea mays] >gi|195625718|gb|ACG34689.1| 40S ribosomal protein S9 [Zea mays] >gi|219885117|gb|ACL52933.1| unknown [Zea mays]
Score 922
Evalue 1.75239e-97
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig2012
ACCACTGCTTGAAGGGGGCAGCATCAACTTGCACAATGGCATTCTTGACAAGGGTCTGAGTCCTCACAAGCTCATTGTTTGACGAATTGTAAACCACATC
CAGGAGACGGGTCTTGCGATCAACTCGACCACAGAGCGGCGGCGGCGGCGGCGGCAGCGGAAGAAAGAGGAGAGAGCTCCAGCCATGGTGCACGTCAACT
TCTACCGCAACTATGGTAAGACATTCAAGAAACCAAGGCGTCCTTATGAGAAGGAGCGTCTTGATGCAGAACTAAAGCTGGTCGGTGAATATGGACTGAG
GTGCAAGCGTGAGCTCTGGAGGGTTCAGTATGCATTGAGCAGGATCCGTAATGCTGCAAGACACTTGCTCACACTGGATGAGAAGAATCCCCGCCGTATC
TTTGAGGGCGCGGCTCTTCTCCGTCGCATGAACCGCTATGGTCTCCTTGCTGAGGGCCAGGATAAGCTTGATTACGTCCTTGCCCTGACTGCTGAGAACT
TCCTTGCAAGGCGCCTTCAGACTCTTGTCTTCAAGGCTGGCATGGCAAAATCCATCCACCATGCCCGTGTCTTGATCAGGCAACGCCACATCAGGGTTGG
CAGGCAGATCGTCAATGTCCCCTCGTTCATGGTGAGGGTTGAATCTGAGAAGCACATCGACTTCTCACTGACAAGTCCATTCGGTGGAGGCCCTGCAGGC
AGGGTGAAGAGAAAGAACCAGAAGAAGGCAAGTGGTGGCGGTGACGCCGGTGGTGACGAGGAAGAGGAATGAGGAACTAGTAGCTATCACCTTATATTTA
TCAAATGTTGGTGTTATGAGTACTTTAGCTGAGAGGCCTGAGACTTTCATGGGTTATCCTCTTGTCATTTTGTCACTTTATCACTGTTGTTAGCATGTAT
GCACTGCTTTATGTTTGGAGCTATTTGGTCGTGATGAAAGTTATCTAAAAATGTTCTTGACTATGACCTGGAATCCTCCTTCAAAAAAAAAA
page-top