Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1981
Contig Information
Length 862 bp
Tissue Callus
Clones 7 Clones [Download: CSV  ,  FASTA ]
whcs8a21    whcs13o12    whcs17a02    rwhcs10f22    rwhcs8a21    rwhcs13o12    rwhcs17a02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal subunit 8E protein [Brachypodium sylvaticum]
Score 823
Evalue 4.18915e-86
Total Hit Count 424
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1981
GCAAAACATTCTCAGTTCAACCTAGGACTCGAACAGTTTACAGAAAATGGTGTTCAGTATGTCTGCAAACATGACATGGACGCAACATCTAAGAAAATCC
AACGAGTAACATGCAGCAGCTCTTCGGCCTAAGCTGTGGCACCCTTGCCCTTCTTCTTCTGGAGCTTCCTCATGTAGAACTCCAGCTCCTTGCCCTCCAG
GATGTACCCATCAGCTCTGCCACACTGTCCAGGGCGAGACGAAATGCAGGCCAGCAGCCTTCCACCACTGAACTGCTCCTCAATGTGCGAGTCCAGTGTA
CGTCCCTGCTGGCGCTTCTCAAGCTTCCTCTGGACATTGTTGCTCTTCTTTGCTTCCTCTGTGGCAGCAGCAGCAACCTCAGCCTCTTGTCCCTCAGCAG
CTTCCTTCTTGGCAGCTGCAGCAGCTTTCTTCTTCCTACCGATTTCAACTCCATAATGAGTCAGGTACCACTGTTTGAAAGGGGCTGCATCAACTTGCAC
AATGGCATTCTTGACAAGGGTCTGAGTCCTCACAAGCTCATTGTTCGACGAATTGTAAACCACATCCAGGAGACGGGTCTTGCGGGTCACAGCCTCACTA
CCCCATGAGAAGTTACCAGTGTCAAGACGGAGAGCCCTCCACTTCACGTTACCTCCGCGAACACGGACCCTCCTCACTGTCTTGTTGCTCGAAAGCTTAG
TGTTGGCTGGCTGGCGGCCGAGCTCATACTTTCGCTTCTTCCTCCAAGCCTTCTGCTTCCCACCGGTGGCCCGGCGCTTGTGCATGGAGTCACGCGAGAT
ACCCATGGTGGCGTCGGTTGCTTGGCTCCGCTGCTGATTCGCCTGCGCGCCGCCGCAGCTTG
page-top