Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1971
Contig Information
Length 773 bp
Tissue Callus
Clones 7 Clones [Download: CSV  ,  FASTA ]
whcs10e06    whcs2e05    whcs2m15    rwhcs10e06    rwhcs9d21    rwhcs2e05    rwhcs2m15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit conserved hypothetical protein [Talaromyces stipitatus ATCC 10500]
Score 91
Evalue 0.261003
Total Hit Count 84
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1971
ACTGAAAATTACAAAGCAGTCCCTGAAATATGCAGAAAGGACCCCAAAGATCTGAAGAGGAACGCAATCAGGTCCAAGCCACTCCCGATCGACTCCAAAC
TCGCCGGCGCCGGGGACATCACCACTTGGTCCGACGAGTTCTTCACCGCAGCAAGCCGTGAACATCGAGCTAGAGTAGCACTGCCTCCCATATAGCTTCA
AGGCTAGGAGGAAGAGGTTTGGCCGCCCTTTGGCCAGAGGATTCGGTGGCGCGGCGGCGCTGCAAGCCGGCTGTCCGCCGGGAGCGCCAAAGCTCAAGCA
CCATCGATGATTTGCTCTGGAACCGGTCGCAAGAGCCGTCTTCATACCAGTCCCCGTCGACTTGACCACCACCATGGTGACTGCCGTCGGCGAGAGCAAG
CGAAGGGGATTCCTGCATACCAGGGAAGACATCGAGCTTATTTCCGAGGATTCCAGCGCACCTCCTTCCAACAGCAGCGAGCCAACCGCCACCACCAACA
AGAGTATCGCCAGGAACCACCGAACGCGGCTCGGGCGCGCCGGCAGCAAAATCCTCATCGGCATGACGCCAATCTCCGGCACTAGGCCAAACTCCTCTAA
GGAAAAACTAGAACTACACCTACTAGCTGCTATAGAGCACCGCGCACCTCCCCCATCACCTCTCCAACCGGCGTCGCCGGCGGCGAAGATCCGGGATCGG
GCCGGGCCTGAGCTGCTTTTGTTTTCNGAGATCTGCNAGCTGCTGCGCGCCTCCGAACGCCCGGCATCGTCAA
page-top