Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1959
Contig Information
Length 1183 bp
Tissue Callus
Clones 7 Clones [Download: CSV  ,  FASTA ]
whcs14c23    rwhcs10c17    rwhcs10l11    rwhcs4a21    rwhcs4p09    rwhcs14c23    rwhcs20f21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit heat shock protein 90 [Triticum aestivum] >gi|110270510|gb|ABG57076.1| heat shock protein 90 [Triticum aestivum]
Score 1531
Evalue 5.49642e-168
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1959
ACATATAATAGAACCAACAATAACGAACTGTTCCACGAGTACCACAAACAGCCTAGCCGCGCCTTAATGTTTGGCCAGCCAAAAGACAAAACCGATACAG
CGACCATCCAACGTCGACACTAAAGATAAAAACAACTAGGCGGTGCAGGGCATGAACATCCGACGACAGGCAGACTTGGCGCTTAGTCGACCTCCTCCAT
CTTGCTCTCACCAGCGTCGTCCTCCAGGGGCGGCATGTCGGTGTCGTTCTCAGGCGCCTCATCGTCCTCGTCAATGCTCAGGCCAAGCTTGAGCATGCGG
TGGATCCTGGTGCCGAAGGTGTTGGGGTCCTCCAGGCTGAAGCCGGAGGTGAGCAGGGAGGTCTCGAAGAGCAGCATCACCAGGTCCTTGACTGACTTGT
CGTTCTTGTCGGCGTCGGCGCGCTTGCGGAGCTCGTCCATGATGGCGTTCTCAGGGTTGATCTCCATGGTCTTCTTGCTTGACATGTAGCCAGCCATGCT
CGAGTCCCTCAAGGCCTGGGCCTTCATGATCCTCTCCATGTTGGCGGTCCACCCATACTCGCCAGTCACCAGACAGCAAGGGGAGTCCACAACACGGTCA
GAGACGATGACCTTCTCCACCTTGTCGCCCAGCACCTCCTTGATGACCTTGCACAGCCCCTCGAACTTCTCCTTGAGCTCCTCCTGCTTCTTCTTCTCGT
CCTCGCTCTCATCGAGCTTCAGACCCTCCTTGGTGGCAGAGACAAGCTTCTTGCCCTCAAACTCCTTGAGCTGACCAATGGCATACTCATCAATGGCGTC
AACCATGTAGATGACCTCATAGCCCTTCTTCTTCAGCTTCTCAAGGAAGGGAGAGTTCTCCACAGCCTTCTTGCTCTCACCGGTGATGTAGTAGATCTCG
TTCTGTCCCTCCTTCATCCTAGTCACATAGTCCTTGAGGCTCGTCAGCTCATCACCACTCTTGGTGGAGTGGTACCTCAGAAGCTCAGCAATCTTGGTCC
TGTTCTGGGAGTCCTCGTGGATGCCAAGCTTGAGGTTCTTGGAGAAGGCCTCGTAGAACTTGTTGTAGTCCTCCTTGTTCTCAGCAATCTCAAAGAAGAG
CTCAATGCACTTCTTGACAAGGTTCTTCCTGATGACCTTGAGGATCTTGTTCTGCTGGAGGGTCTCACGGGAGATGTTCAGGG
page-top