Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1921
Contig Information
Length 1687 bp
Tissue Callus
Clones 6 Clones [Download: CSV  ,  FASTA ]
whcs10d22    whcs19m17    whcs1b01    rwhcs10d22    rwhcs19m17    rwhcs1b01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_36548 [Oryza sativa Indica Group]
Score 1506
Evalue 7.05838e-165
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1921
AGCGAGAGGGAGACAGAGGGTTCCGTGCTCATCCACGCATCGAATCGGGTCGACCCCCCTCAGGCGTCTCGTCGGCGCCCTGCCCTGCCCGGGCTACTTT
TTCCTTTGCAATGGCATCTGGAACTGATGAGAAAGCCAAGATGGAGAGTTTGACATCACCTGCAGCCTTTGTAGAGGGTGGGGTCCAGGATGCATGTGAT
GATGCATGTAGCATTTGTCTTGAGGCTTTCTGTGAGAGTGATCCTTCCGCATTGACAGGTTGCAAACATGAGTTCCATCTCCAATGCATCCTTGAATGGT
GTCAAAGAAGTTCTCAGTGCCCTATGTGCTGGCAGCCTGTCAGTATGAAGGATCCTACCAGTCAAGAGCTTCTTGAGGCAGTACAGTGGGAGAGGAATAT
AAGAACCAATCAAACTCAAAATACGACTATATTTCATCATCCTGCTCTTGGTGATTTCGAAGTGCAGCATTTACCTGTTGTTGGTAATGATGCTGAACTT
GAAGAGCGTATACTGCAACACCTAGCTGCTGCTGCAGCAATGGGAAGGTCACACCAACATGGTAGAAGAGAGGGGCAGAGGAACCGTTCTGGCTCTCATG
GCCGCCCACAGTTCTTGGTTTTCTCTGCACATCCAAATACTCCTGCTGGCTCTGTTTCATCATCTTCCACTCAGGGGGAAGGTGCTGATGACCTGAGGAT
TCTTGTTCCCAGAGTTGGTGACTTACCACCACATGCTAATCCCATTGAAGAAGCAGGCAACCAAAGTCCGGGGGTCCTTACCTACGATGCTGAACAAGAT
GCTGTTGTTTCATCTGGAAATAGTACCCCCGTATCCAGTCCTAGGTTTTTCAACAGGAGACATTCCTCTGGACAATCAACTCCAGTAGGTAATGACAGGG
CTGGGCCATCAGATGTTCAGTCTTTCTCAGATTCTCTAAAGTTGCGCTTAAATGCTGTCTCCTCGAAGTACAAAGAATCTATTACAAAAAGTACTCGAGG
GTGGAAGGAGAGGCTTTTTTCACGTAACTCATCTGTGTCTGATCTTGGTTCTGAAGTGAGACGCGAAGTTAATAATGGAATTGCATCTGTATCGAGGATG
ATGGAGCGTTTGGAAACTAGAGGAAGTGGTAGACCAAGCTATAGCCCAACAACATCTACTTCTGAAGTTTGTCTCACTACAGAACCAAGCAATGAGAGGG
TTAACGAAAGTAACTCTAATACTACTACGAGTACTAGCAACACTTCTACCCCTTGTGTGACCACGTCTGGTTCAAATTAGTGCATGCTACTGTTTCTGAA
GAAGGCCTGCATGTGCCCATTCTTCATCTTCAAAGGTATGGGCAGGTGGCATAGCTGAAACTCCAACGACATGATGATGCCATCTCAACTGTTGCATAAA
TCACCACCAGAAAATCTGAATTTGATGTATTGGTTTGATGAAAGGGCAGTGGGCCTGAGGTATTGCTTTGGAAGTCAATTTAATTTCCTGTTTTATCTCT
GTAATTAAAAAAAATCCTTCCGAGACTTCTGTTTACTGGTATAAATATTGGATGTGGTAGTTTCCATAGCAGGCCTAATCCTGACAAATACGACTCGTAC
AGCTAAGAGTTTGATGCTGTTGCACGGCTATTATATTAAAAATTGTATGCATGTTCGATGCATTGACATTGATGTCTCGGAAACAAA
page-top