Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem2a18
Contig Information
Length 539 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem2a18   
Homology (BLAST) Top Hit glutaryl-CoA dehydrogenase [Zea mays]
Score 651
Evalue 8.42943e-67
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whem2a18
GAGTGCCGTTTCTATAGCANAAGTTGCACGGGCTTGATGCAAGCTGCTCCACATTTATTCTAGCTGCACTCCTCTTTGGCAATGTCCACAATTGCCCTTT
GTGGATCANAGGCTCAAAAGCANAAGTACCTACCATCGTTAGCTCAGTTTAAAACTGTTGGTTGCTGGGCTTTAACAGAGCCAGATTATGGAAGTGATGC
AAGCTCCTTGAAAACTTCANCAATCAAGGTACCTGGCGGTTGGCAATTACATGGCCAAAAGCGCTGGATAGGTAACAGCACGTTTGCAGATGTGCTTGTA
ATTTTGGCTAGGAATGCAGACACAAAGCAACTAAACGGATTCATTGTGAAGAAGGGAGCGCCTGGTTTGAGAGCCACAAAAATTCAAAACAAAATTGGAC
TTANAATGGTTCANAATGGCGATATCCTTCTGAATAAAGTATTTGTCCCANAANAANACANATTAACANGCATCNATTCATTTCANGATATAANCAAGGT
CCTANCAATGTCNCNTATTATGGNGGCTTGNCNNCCNNT
page-top