Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhem20o01
Contig Information
Length 727 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem20o01   
Homology (BLAST) Top Hit hypothetical protein OsI_05296 [Oryza sativa Indica Group]
Score 625
Evalue 2.79423e-63
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhem20o01
AACAGGCTGTAGAAACGAATTTCAAACAACTACCAGCACAAATGAAACTCACACATTTTTAATACTCCTGCCTACCAGCACAAACATCATCACCAACTAA
TTAGGCTCTCACATTTTCTCAGCGAGGGTTGGTGCTGCGCACCACGCCGCTGAGAAGGTTGCTGCCGGAGGCGTCCGAGGACGACATGTACTGGTAGGCC
ATCATCAACCCCCCGGCGGACGACGACGACAGCTGCGTGCCTGTGCGGCCCGGGGTCCATGGACACCGAGACTCCGACTCCAACGGCACGCTATCCGTCT
CTGGCGTCATCTGCCATATCGTCTCCAGCTCCCGCACCACCTCCACCATGGACGGCCTCGCGTCCGTCTCGTCCCGGCAGCACCGCAGCCCCAGCGCCGC
GAACCTCTCCACGCACTCCCACGGGCACGGACCCATCCGTGTGTCCACCACCGACAATATCATCCCTGACTGGTTCGCCGCCACAACCTCTCTGACCAGG
TTTTTCCCATGAGAAATGGGCTGCATCCCTGTCAGCAGTTCCAGAAAAACGACACCGAGGCTGTACACGTCGCTCTTGTCCGTCAGATTATGCGTGAGGA
AATACTCCGGGTCAAGATAACCCGGGGTACCCTTCACAACAGTGGACACATGACCAGGGGCGACCCCCTCCATTGCCGGCAGTGGGGCAAGCCCTCGAGA
GACCAAAATCAGAAACCTTTGCTACAA
page-top