Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem2a16
Contig Information
Length 595 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem2a16   
Homology (BLAST) Top Hit hypothetical protein OsJ_027119 [Oryza sativa (japonica cultivar-group)]
Score 939
Evalue 6.94581e-100
Total Hit Count 158
Registered year 2003
Contig Sequence     [ Download ]
>whem2a16
GAGCAACGATGGCACTCAATTTGTGGTCACATCCCCTGACCGCAGGATAAGGGTATTTTGGTTCAAAACTGGTAAATTAAGACGCGTGTATGATGAGTCC
CTTGAGGTGGCACAAGATCTTCAGAAAAGTGACGTTCCGTTGTATCATCTTGATGCTATTGATTTTGGGAGAAGAATGGCTGTCGAGAAGGAAATAGAAA
AGACAGAAAATGTTCCTCAACCTAATGCTGTATTCGATGAGAGCTGTAACTTCCTTATTTATGCCACCCTTTTGGGCATAAAGGTTGTAAATTTGCACAC
AAATAAGGTTCCCCGTATCCTGGGGAAGGTAGAGAACAATGAGAGGTTTCTGAGAATTGCTCTATACCAAGGTGACAAAGGCAACAAGAAGGTTAGGAAA
ATTCCTTCAATAGCTGCTAATGTCAATGACACGAAGGAGCCTTTATCAGACCCTACTCTGTTATGTTGCGCCTTCAAGAAACACCGGATATATACCTTTA
GTCGTANAGAACCTGAAGAGCCTGAAGATGCCACTAAGGGTANGGATGTTTTCNATGANNAACCCCCNCCANAANAACTTTTGTCTGTATCANAA
page-top