Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem2a14
Contig Information
Length 577 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem2a14   
Homology (BLAST) Top Hit hypothetical protein OsI_02594 [Oryza sativa Indica Group]
Score 308
Evalue 9.55375e-27
Total Hit Count 56
Registered year 2003
Contig Sequence     [ Download ]
>whem2a14
TGCGCATTCAGATTCAGTTCAGTAAAACTTGTAATGAAAGTTTCATCAATATTCATTCAGTGGATTCTACAGGTCGTCAACAAAACTGCAATGGTATAGG
CGTAACTTGATTGATATATGCATGTATACATCAAGCATACAAAATTTTCTGCCAGCCATCTAGCACAAATTTTCGAAGTCCAACAGCAGAACACATTGCC
ACGCAGAAGTGAACGCTGTACAACTTGCTTCTGCTTGATCTTCATCGCTGGCAGAAGTAACTTGTTTGATCTTCATCTAGCACCAACAAAAACTACCTCA
ACCACCTTCCCATCTTCATCGCTGTTATCTTCCGCTTCTTGTGTTCTCGGTGCTTGGCAGACATACGCAACTTCCTCTTGGCGTGCCGCGCTGGGTCGAC
CGCTGCAACAAGCTTCTCAGCCTGCTTTCTGCTCTCCCTCTTTGCTTTCAGGTCCTTCCGGACACTGNTGNAAATTTCCNCAAATTTCTCANCACCANTG
ANATCACGNANNTTGTCCCTGGNCACCTCTGCTGACTGNTNANCTTCATCNCTGANGACTTTCNCANCNNNTCCNNC
page-top