Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem2a11
Contig Information
Length 609 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem2a11   
Homology (BLAST) Top Hit hypothetical protein OsI_08701 [Oryza sativa Indica Group]
Score 278
Evalue 3.25977e-23
Total Hit Count 89
Registered year 2003
Contig Sequence     [ Download ]
>whem2a11
CGCCAATACGAACTCACTTTTTGCAACACACATGCTCAGCCAATTGGGCAGCCAGCTGGGAGGTCATGGAAAGAACTATTTTTTTCTCTTGTTGCAATAC
ACAGGCTCAAAGGTGCTGGAATTCCTCACATTGGAGTGAAAACAATTATGTCTATGCATGTAGCAGCAAGGGGATGAGGCAGGGGAGGGGTGCCGTTATT
GCATACAAGACATGACTTCCACTACAAGAAACACTTAAGAAGAATGAGTGCCTTTTAGGCCCAGGTCATATTCAAACAACAATTTGCTATCATGCTCTCG
CCATTGCATTCAGCTGTATGAGTGCATACAAGCTTTCAATTCAGCATGAAACACAGACACATGATATACTGGTAAAATAGTTAGGGTCTGATGATTCATG
AACAAAAGATTCATAAAATTGGTTGAATCATTTAAGGAGCGAGAACAGCAAGTATGTGATGAAAAATTATTTCCCATGGTTGTTTCACTCTTGGTTCAGG
GATTCTTGCACATTATCAAAGTANCAACTTGTCAAGGTCATTGCCAAATGCCAACCAATGTGCCAGCATGGGACCGGGGAAAGGGAAAGACCATGGAGGT
GCAAGTCTG
page-top