Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhem6j18
Contig Information
Length 760 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem6j18   
Homology (BLAST) Top Hit hypothetical protein OsI_14437 [Oryza sativa Indica Group]
Score 955
Evalue 1.64436e-101
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhem6j18
TAAGTAGTTACTAGCATGCATGTATTTGCTTGCTGCCTTGTGCTTCACTTCCAATCTCTCCCCCCACAAGCTTCGTCTTTACAACCAACCAATCTCCTAC
TTCCACAGCTTCACCCATCTGTCGTGGCTCGCCGACGCAATCGACCCCGTCAGCGGGGAGTGCGCCAGCGCCGCAATCAGCCCCTCGTGCGCCGGCACCA
CGTTCCTCTGGTTATCCGCCACGCTCCACAGCTCCACCGTCTGGTAACCACCAACGATCAAAACTTTCGGGTATCTCGGATGGAATATGCATGACTGGTA
CTGGTTCCCGTGCGACCTCAGCTCGTGGATGCACTGCCCTGACGCCACCGACCACACCTTCACGCTGTCCTGGCTCGCCGACGCCAAATACTCGCCCGTT
TCGTCCCAGCAGATGCAGTTTACCTCGCTAGTGTGAACCTTTGCCTGCGAATGTAAACTCGTGTCCGTGTCGATATCAATCATGTTCACCGTGTTTCCTG
CTGCCACCGCAAGGAGCTTTCCGATCCGAGGCTGAAACCTCACCCTACCAGTACCGCCCTGTTTCACCCTGGACACGCGTGAAGCCGCATTTTGACCAAC
TGTCCAGAACCGGATCTCTCCATTGTCGTCACACGAGCATAGAATCTCTGTCAATTTCGGGTGAAAATCTACCGATGTTACATGGGAGGAATGCCCAAGA
AAAATTTGCAATGCGCCGGTTCGCTCGGCTGCATTCCATAGTCGAACAGTTCCATCAGAA
page-top