Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhem6j23
Contig Information
Length 700 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem6j23   
Homology (BLAST) Top Hit hypothetical protein OsJ_008200 [Oryza sativa (japonica cultivar-group)]
Score 786
Evalue 5.44808e-82
Total Hit Count 103
Registered year 2003
Contig Sequence     [ Download ]
>rwhem6j23
CAGGGAGGAGAAGAAGAATTGAAAAACCTTCACTTATGCTGTTGTCCGAACGTAGAAACTGAACAGAACACGCTCCTAGCTCCATGTCATGTTTAGCTAT
CGAAGAGCTTGAGGCCGAAGCCGACGTCCTCGCAGTGCCGGACGTAGGGCTTGACGCGGGCCACGTCCACCTCCTTCTTGGCCCGGCACCCGAGGATCGG
CGGCGAGTGCAGGCACGGCTCGACGGACGTGGAGCGGACGCACGCGACGTCGGACACCTCCTTGTTCCAGTCGGGGCGGAGCAGGATCCACGGCTTGACG
CCGGCGAAGCCGTAGGCGACGTAGCCGAAGGTGGACCAGGCGCTCATGGCGATCTTGTCGCAGTAGCTGAGGAGGTAGATCTCGGCCAGCGCCTTCTGGT
TGTGCTCGTTGGACGCGTACTCCTGCTTCTCCTCGTGGCTCGGCTGGTACACCGCCACGATCTCCCCCGTCTTGGTGGGGCTCTCGTANTANAGGCCCCG
GATCTTGTCGTANTANCCCGAGTANAGCGACGCGATCANCACGGCCTTCACCTTCCCGTCNTCNCCGGTCNCGTTCNCCGGGGACNCCNGGTCNCCNANC
TCCNGCANCANGCNCTGCTCCCTGATGCACCTGNTNANCTGTCNTACNTGTTCTCNAANTTNANCNNNTTCTCCNNNAANATCCTNATCTNNAANCCNAT
page-top