Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhem6k06
Contig Information
Length 454 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem6k06   
Homology (BLAST) Top Hit hypothetical protein OsI_08182 [Oryza sativa Indica Group]
Score 203
Evalue 8.63274e-15
Total Hit Count 60
Registered year 2003
Contig Sequence     [ Download ]
>rwhem6k06
GCAACTTAACCTAGCCGTTAAGTTNGCTCTCCTTGCGACTGTCTAGAGGACCAGCAAGCCACTCTGCAAAAACAACTCTTGCAAGAGTGCTTATATTATT
CGATCGCTCCAGGGGAGCCTAACGCTTGCACGCGTGGGCACAGCCATATCAACCATTCAGTGTAGACTTGTAATGGTTGTCATCGATAGTTGGATAGAGG
TTGCCAACATCAATAAGATGTGTAACAGTCGACCTGGCAAGTGCATCTGATATGTTAAGACGGCTTGCAACCTGTTCGATACTAACTCCATGCTCCAGGT
TTACAAGCACTGGGTCATGAAAAACATTCATGACCATATCAGTTAAATCTTGCCCACCANCATTCCCAGATGCAGATAGTGTTGGGGCCTGATTATTAGG
GGGTGGAGCTTGGTTCCATGATGCATTAGCAGTTACTTGAGGCTGTGTCCCAGA
page-top