Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhem6k01
Contig Information
Length 531 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem6k01   
Homology (BLAST) Top Hit hypothetical protein [Zea mays] (no hit)
Score 254
Evalue 2.59481e-20
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhem6k01
GGATCAAACTTGTGGATTTGGTACATTACATATATTTCTACACTGCCTTGATACATCAGCTTATATACAAATGCAACATGTTGCTCTCGACAAACAATTC
TGATCTTCCTAACAGAAAAACAATAATCCTGATGCATAAAAATAGACCTATCAGTACGTCGACCAAGCTTGAAGGTGTATTTTCTGCAGCAAAGGAGCGA
GGGCTGTTTATAGCTCTGCTTCTGCTTTTGAATCAAGTACACTCGTTGAGCACCAAGGTTGTAATGTCATTGTGATACTGAATATCAAGCACTTAACCAA
AGATTTACGGCGTGGAAATCCAACCTTTGGAACCCAAGCACCGGTATCTTCTGCATTTCTTCTTTGTTGATTGTTCAAAACATCAAGCTGCTCGGGACAT
CACCAATAATTCTTCTATTGGCCACTAAGCAAAACAGTTTGACTGGATGTGTCTAATATCTAAGTACTGTGCATCTCTTGCTGCTGAACCACCGCAGGAT
GAAGATACGATGCTGAGCAGCTTGGTGTAGC
page-top