Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhem20o05
Contig Information
Length 684 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem20o05   
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 254
Evalue 2.59481e-20
Total Hit Count 206
Registered year 2003
Contig Sequence     [ Download ]
>rwhem20o05
ACAAGCACAATTAAATTTAATATACATGGTGCTGTGAACTGCTGCAGTCTAAGAACATGGTTAGAGAAAGAAGAAAACAACTCATATGGGAGGAGCACTA
TTGATCTAAAGGATACACTGGATGCCTGCATAGCTGACACAGGACTTGTGCTTGATCATCTGGAGTTGGGCTGTTTCATCATGTACCACCTCCACACCGG
TGATGACAGCAGCCTGCTTGTCACTCTTGGTCCTGCCCTCGTCCCCAATGTCGAAAACTTTGTTGATGCAAAACCTGCCGGCTCCCAGGTAGAGCAGGCA
GCCCCTTATTTGCACCCAGCCCCGAGGCGGGTCAAGGACTTGCCACTCGCGTAGCATCCTGGGAGCCCCGCCGTCGAGGCTGGAGAGGTCCGACGCACAC
AGGTTGTTGGGGCTGCTGTCAGCCATGCCGAACCAGAGGTTGTCAAGCTCGGGGACATGCTCGGCCCTGCCGCAGAAGGGCAGCGCCCAGCGGCCAGCCT
TCCTCCACTGGCGGCTAGACGTGTCGAAGCAGTAGGTCCCGACGGGGCTGCGCCCGGAGGANGATACNCANATGGTGGANCCTGCATTGANCANCGTGTA
NGANTGGATANCGGTGCANTCNTANGCCGNNTCNTTNACATANGNCNNNNNNNNNANCCNNNTCCNCTCCCNNNANNTNTTNTC
page-top