Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1p07
Contig Information
Length 199 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1p07   
Homology (BLAST) Top Hit putative H-box binding protein, KAP2, with alternative splicing isoforms [Oryza sativa (japonica cultivar-group)]
Score 274
Evalue 5.09894e-23
Total Hit Count 18
Registered year 2003
Contig Sequence     [ Download ]
>whem1p07
ATATTAAAGTTGTTGACGAAGAAACAAAAGATGCCCTTGAAAATCTTCCTAAGGGAACTGCCCCTGGTGACTTTCTGGATGCTATTGTTGTTGGTTTGGA
TATGCTGATAAANAGATTCGGAGATACCANAGCAAAGCAACGTCTGTGTCTAATCACCGACGCACAACATCTGCTAAGGGATCCGCCCCAAGGGACAAA
page-top