Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhem20o16
Contig Information
Length 723 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem20o16   
Homology (BLAST) Top Hit hypothetical protein [Oryza sativa Japonica Group] >gi|125559690|gb|EAZ05226.1| hypothetical protein OsI_27424 [Oryza sativa Indica Group] >gi|125601595|gb|EAZ41171.1| hypothetical protein OsJ_024654 [Oryza sativa (japonica cultivar-group)]
Score 449
Evalue 7.02638e-43
Total Hit Count 151
Registered year 2003
Contig Sequence     [ Download ]
>rwhem20o16
TTGATTCACTTTCTAGGAGGACAAAGCACAACATGAACCAGTGACAGTCAAGCAAGGATTTTGGAACAAGCCAAACTGGTTTCTACATCCAAAATGCTAC
AGGCATAAAGTGATCTTTATGCCTAGACACTATGAAGGAGCGCGTGGAGCGGTGATCTGTGATCTGCAGCTCTCCCTTGTGATTGAACTTGAGGCCAAAT
AAGGTGATATGGAGCACACAGCCGGCATAGTCTCCCCGAGCCAGTGCCTCCTCCAGTCCCTCCCGTTCCACGCGTTGGACGAGGCAGAACTTGCTCATGC
CCACATAGCTGAGAGAGACTCCCATGTGTGGCTTCCGGTCCTTGCAGAACAACTTCTCCTTGGTTGTCTGGCAGTCCAGCTGCAACGTTGGAGTCGTGCT
GTGGCAGCTGGGGGAGGCAACTTGGCAAGCAGAGATGTAGCCATCCCGATGAAGGCCAACCCAGGCGTTGAGCTCCCTGTCAAAGTGTGCTTGGCCGCTG
AATGACAAGGCCCACTCCCCATGCCATCTCCACACAGAATCCTTGGTGTTGAATGAGTAGGTGCCCATGCAACCTTTGCTAGGTGCCGTCATGAAGTTAG
CTGTGGACATAAAGATGGTGCATCCATCCGGGTGTAGTGCATAGGAGTTGACTCGACGGTGAAACGTTGGCGGTGGTGGCGGCAGAGTCTTCCAGGACCA
GCCCTCGGTTGGTTGTTGCANCG
page-top