Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhem6l23
Contig Information
Length 694 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem6l23   
Homology (BLAST) Top Hit hypothetical protein OsJ_020564 [Oryza sativa (japonica cultivar-group)]
Score 562
Evalue 5.10785e-56
Total Hit Count 57
Registered year 2003
Contig Sequence     [ Download ]
>rwhem6l23
AAATTGCAGGAGATCAATCCCTCAGGGGCATTACAGAGCAAGAACACGAAAGTCAAGAAAAGCTCGCCGACGATGCTACGGCAAAGAACACTGATGAAGG
GGAGGACCATCTTTCCATCTCCGAAGGTCTGGGTGACTCGGGAAGGATTGAGAAGCCGAGAGAAGAAGCTGCCAACAAGCTGAGGACATTCTCGGGGAGG
GCGGTCACTTGCCAGGGCAGGAGCGTGAGGATCAACATTCCAGTCACCACGCCATCGAGGACCGTGTTTGCCATCCGTGAACTTCTGTTCGATGACATGC
TAAGCCAGTCAAGGAAGACTGGGGGGAATGGTGGTGATGGCAGTGAGAAGTTGAGCATCAACAAGAAAAAAGTGCACCAGGCAGAGAAGATGATCAGAGG
AGCCCTGGTTGAGCTATACAAGGGCTTGGGGTACCTCAAGACGTATCGGTAGGTGTAGCTGATGACATGGTATGTTGTTCTGCTTTGTGCACCGAGTGGG
TACTGACGGGGAAAGCACTCTTGTTGCAGGAGCTTGAACATGCTGGCTTTTGTGAAGATTTTGAAGAAATTTGACAAGGTTCCTGCCAATGCCTCTCTCC
TTATTGCATTGCCTGAAAGTTATCACATATAAGCAACGCTGAAAAGAACAAAACATTTTTTCGTGTTGCAGGTTACAGCNAAGGAAGTGCANAC
page-top