Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem14m21
Contig Information
Length 458 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem14m21   
Homology (BLAST) Top Hit expressed protein [Oryza sativa (japonica cultivar-group)]
Score 235
Evalue 1.67358e-18
Total Hit Count 80
Registered year 2003
Contig Sequence     [ Download ]
>whem14m21
AACCCTGATGAGCGCTGTCAGATCTACATCACTGATGGAAACCAGCGGGCTGTGGTGACACTTTGGGGGACACACGCCACTACTTTCAACACCGCGGGCC
TCGTGGAGAGCTCTGCCACGCAGCATATCGTTGCTCTTTTTGTAGGTGTTACAGTGAGTCACTATTCAGGTTTACTCGCTTTCAAATCGACATCAGTGAC
CAAATTATATGTTAACATCCCAATACCAGAAATGGAGACCGTCAGACACAACGTGACAGGTATTCCATCCCAGATTGAATGGTTTGGTAACCATCGAGCA
AGAAAAGAGCCGGTAGATGCAAGAATAGCAGAAATTGCTGAGCTTGAACCCAACCACATCATGGACGAACGCTACAGATTTTCAATTCTTGTCACTGAAG
TTATCCTATCAAGTGACTGGTGGTACAAAAGTTGCAAAGACTGTCGAAAGAAAGNTCA
page-top