Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1o21
Contig Information
Length 123 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1o21   
Homology (BLAST) Top Hit SAM domain family protein [Zea mays] (no hit)
Score 113
Evalue 0.000233904
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>whem1o21
GCGACAGAAGAATGGCGGAGGCTTACCAAATGAAGTTTTGACACACGTTATGTATTCANACATTATTGCAAATGCTTCTGATGAATCCACATTTGGATCA
CTCTCAACATAAAACATTTTTCT
page-top