Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhem15a23
Contig Information
Length 707 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem15a23   
Homology (BLAST) Top Hit hypothetical protein OsI_27048 [Oryza sativa Indica Group]
Score 815
Evalue 2.4334e-85
Total Hit Count 483
Registered year 2003
Contig Sequence     [ Download ]
>rwhem15a23
AATGGCCCCAGCGCCATATGATATGTCCTAGTATATCTCTACGCACGCCCAATCTTCTCCACCAGGCGTCTCTCGATCTCCATCCTCTTCTTCATGAGCA
GCGTGTACTTCTTCAGGAGCTCCCTGCCCTCCTCCCCCGGCGCCGGCACCGCCAGCTTTGCGCCCAGCGAGGTCTTCTCCAGGTTGCCCGTGTACATCCG
GGAAATGGGAACAAAGCCTCCTTCCTCCTTGCACAGCCACCCGTGGGCAGCTCTCAGGGCTGCGCCCAGCGAAGCCGAATCGGGTCTCTCAACTGTGAAG
ACGGGGCAGCCAAAGATTTGCGCGATCAACTTGAGGATGCTCTCATTGGAGGATGCCCCACCGGTTGCTATGATCCGCTTTGGTGGGTTGGGCATGCCAA
ACCGCTCGGCATGCCCTCGCATCGACAACATCTGGCCCTCGACGATGGCACGGACCTCANATCGTGGATCGAATTCTTGCACCTCATGCTCCGTCANATT
GTCANATGANGCGTCATTAAAATTCTTGACAATGTATCGGNGGAAACCAACTGGAANAGGAGGCANGATTTCATGGNCTTTGTANTANAATCCTAACTTC
CCATCATTCANANGGGGNGNTTTCTCTATATANNNGNNNAAAANATCCCANNATTTTTNTGNNNANTGATTNNNNANATNTTNNCNNNNNAATGAANNAT
TTTTGNA
page-top