Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhem20o17
Contig Information
Length 793 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem20o17   
Homology (BLAST) Top Hit hypothetical protein OsJ_030947 [Oryza sativa (japonica cultivar-group)]
Score 760
Evalue 7.2782e-79
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhem20o17
CTATTTCTCTTGGTGGTTGTCACTTGCTACAAACGCCAGGTTCCCTTCAGAGGGATCCAGCATGTAATCATCTTACATATACAGGGACCGAATACATGTA
AAAGGAACATGATTAGTTAAGATGGGAACAACCAAAAGGCAGAAATGACTTGATTTTTTTTTCCTTGTTTCCAACTTGCCCTACTTGCCTGCTACCTACA
TATTGGCTTGCGAAATTCTCTCCCTACCTATGTTATCAGGAACCAGAAAGTGCTACTTCGGCATCTCTGTTGTCCATAATACCCAAGAAGTCACCAACAA
TTGCATGCTTGCATAAGCAGAATTCATATTGTGAGGTTTTCCTGGATGGCCGTGAAGGAGCCACAAATGTTTCCGCCCATGTCTGGGAATGTCGCACATC
CTGGCAAGGGTTTCACCTTGCCTTTACGGTCAACACTTACAGGGTACTTGAGGAGGTGGCCTCTCATCTCAGTCACCTCATTTGCAAAGAACTGATCCCA
GTTATGTTGCCCGAGTTGACGAACCCGCCTCATGCACTCTAGGCTCTCTGGATGGTTAAAGTCTTCCTCGATAATTCCAATATGCTCAGCCCAGAGGGAC
ATTCTGTAGCCATAAATCTGTCCACGGGGAGCAGAAATTTTATTTGCCCATGTATACTGTGGTTGATATGCTCCCATTGCAATCTCAGTATCTCTGATCC
CTTCCATCGACCTCTGGTTGATATTAGCTGATCCAATGATCACATATTCATCATCTACGATCATACCTTTTGAATGNACATAAACCATGAATC
page-top