Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1o12
Contig Information
Length 177 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1o12   
Homology (BLAST) Top Hit Os11g0677100 [Oryza sativa (japonica cultivar-group)] >gi|113645672|dbj|BAF28813.1| Os11g0677100 [Oryza sativa (japonica cultivar-group)]
Score 171
Evalue 4.40167e-11
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whem1o12
ATCTTCATCTTGTGTTCTGGTTTATGAAGATACGACCGTATGTTCACCGGCTGAGCTCCAGGGATAAGAGGTATCCTATGATTGCAAGCACGCCAGGGAG
GAAGGCCTGTTGGCTCAATGAAATCATCTGGGAACTCATCNAGGACGCGCTGGATGCAACCAGGAATTGGAGTTGTA
page-top