Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1o09
Contig Information
Length 361 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1o09   
Homology (BLAST) Top Hit hypothetical protein OsI_29416 [Oryza sativa Indica Group]
Score 190
Evalue 2.76729e-13
Total Hit Count 85
Registered year 2003
Contig Sequence     [ Download ]
>whem1o09
GTTTACGGTTACCACTGGGACGAAACAAACACCTCCATAGGTGTACAGCAGTGATATTACACACAGAGAACGTACGAAGATAACAGTTTCACAGCAAATT
CAGAAGCAGGTCATAAAACCCCGGTACGTAACCCTAACGTTGCTGCTTCTTCCTATGGTCCTGAAATCTCTAGTGTACACCAACACCACAAAAAATCACG
GCTTTTTACTGTCCGGAGGAGGAACCTTAACGCCCATAAGTCCAAGCAGGTTCGAGGCCGGGCCAGGAAGGCCCTGCTGAGATGAGTACGAGTTAAGGAA
GCTCTCCACAAGGTTCAAGTTCACATCGACTGGGGCCATCTCCCCATCATCACTATCGGCA
page-top