Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1n13
Contig Information
Length 275 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1n13   
Homology (BLAST) Top Hit PREDICTED: similar to mCG22338 [Acyrthosiphon pisum]
Score 74
Evalue 7.8243
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>whem1n13
CTTCTCCCATTCAGGCAGCGACTCTGAACTCCACCTCGATGACCACTCCGACCCAGAGGACAGCTTCTTCTCCACAAGGAGCGCTGCCGATGACGACGTC
CAGGATTCCTCCACCAGTGACGAGGAGGAGGATGACGATGAGGAGAGCCTCCATGAGGAGGAGGATGACGATGAGGAGAGCCTCCATGATGATGAGGATG
ATGATGAGGAGAGCCTCCATGAGGAGGATGATGATGGTGAGATGGGAGAGCTCGAGCAGCAGTATCGCACCCTCC
page-top