Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1n09
Contig Information
Length 223 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1n09   
Homology (BLAST) Top Hit Os06g0164000 [Oryza sativa (japonica cultivar-group)] >gi|55296129|dbj|BAD67847.1| putative transcription factor [Oryza sativa Japonica Group] >gi|113594940|dbj|BAF18814.1| Os06g0164000 [Oryza sativa (japonica cultivar-group)] (no hit)
Score 649
Evalue 4.99716e-66
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>whem1n09
GCGTCAGATCTAGCAGCAGCTGATGCAAGAGGCGACGCGGCGGCCAGCATCTGGAGCAGCAAAGCCATGGCGACGACAGGGAAGTGGAAGCGTGGTGACG
ACTTAGAGCATCGACCGACCCTCTGCCACACAGAGCCTCAGCAATGTGAAGATGAAGATTCTACTGATGGATTATTATAACATAGTTTTCNTCAAGCCGC
TTCTATACNATTGCTGAGAAAAA
page-top