Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhem15b12
Contig Information
Length 793 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem15b12   
Homology (BLAST) Top Hit hypothetical protein OsI_00556 [Oryza sativa Indica Group]
Score 519
Evalue 6.42053e-51
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhem15b12
GGTCCAAAATATATTACATCACACACAATAGACGGTACCAGTAGCTGAAGCAACTACAGAGCACAAGCTTTACCAAGACTCCTAAGGAGTAGACCGAAGC
TACATGAAGAAAGGGGAAGGGGAAAGGGATGTTTACATTACATTGACATACTGACTTTAGGCATCCAGAGAGAAGAGGATCCAGCAAGCTGCTGGCTGGC
TGATCACGTTGCCATCACCATCGGCCTCTTGTGGCCCTGCAGAACTTGCCGGAGGTGCTGATACCCGTCGCGGTAGTGCTCGAGCGAGAAGCACAGCTGC
CTGATTGCCTCCCGCTTCCCCTCTGCACTGTCAAAGGCCATGAGCTTCTGCTTCTCAACCTCTTCCTCGAGCTCACAGACCCGTGCACGCAGGTCTGCCA
CGGACTTCCATGCGGCATCTGCCTCTGCAATCACTTGCACATGCTCCAGGTGCAGCTGATGCAAGTGGCTATCCATCTCCTTCATCTTTTCATCACAAGT
CGCGAGATCACTCAGCAAACCAGACACCTTATTATCAACTGCAGCTTTCTGTGAGGACAGTAACTCGAGCTCTGTCTTAAGATTGGCAATATCTTGCTTC
AATCCAGAGATCAGCTTCTCACTCTCAGCAGATGCTTCTGCCTTTTCGGCATGAAGTTGCTTAAGCTGCGCCTCTGTGGATGACAACTTGTCTTCAAGAG
AAGCATTAGCTTCTGACAGTTGTAGGATCTCAGCATCAAGAGAGGACTTCTCAAGAGAGGATTTCTCCAACTTACTAGCAATGGCATGTTCCA
page-top