Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1m17
Contig Information
Length 530 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1m17   
Homology (BLAST) Top Hit Os01g0170400 [Oryza sativa (japonica cultivar-group)] >gi|113531671|dbj|BAF04054.1| Os01g0170400 [Oryza sativa (japonica cultivar-group)]
Score 432
Evalue 3.08747e-41
Total Hit Count 296
Registered year 2003
Contig Sequence     [ Download ]
>whem1m17
CTATTACTGTTGATAATGCAAGTTCTAATGACACTTGCTTAGCCTACATGAAGAGGTCTTTGACTAATAGGGGCTGTACACATGCAAAAAATCAGTATCT
TCACATGAGGTGTGTGGCACATATTGTTAATCTAGTGGTTCAAGATGGGCTAAAGATAATGTGCCATCCAATAAACAGAATTCGAAGTGCTATCAAGTTT
GTGAGAGCCTCCCCAACTAGATTGGATTTATTTAAAAAGTGTGTGCAGCTTAGCAAGGTAGCGAGTAAATGTTTGATTAATATTGATGTGGCTACTAGAT
GGAACTCCACATTTATAATGCTAGAGACTGCTGAGAAATTTGAGAGGGCATTTAAGCAATATGCACTTCAGGATCCCAACTACAAGACTGAGTTAGAAAA
AACTGGTCCAGAACCTAAGCCTGATACTCCTGATCAGCGGGGTCCTCCAACTCAAAGTGATTGGGTGTATGTTTGTGAGTTCAAATAATTCCTCCAACAC
TTCTATCTCCTCACTANTAANGNTTCTGGC
page-top