Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1m16
Contig Information
Length 160 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1m16   
Homology (BLAST) Top Hit 40S ribosomal protein S15a [Zea mays] >gi|195610836|gb|ACG27248.1| 40S ribosomal protein S15a [Zea mays] (no hit)
Score 92
Evalue 0.0641143
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>whem1m16
GGCGGCGACATAAACTTTAACTCCTAGTGGAGGTCCAGTAGAGCCTTCGTTTTCAAGTTTCTTTTACTACCACCTTTTGTCTAAGTAGTGTAGTGTGTGC
GCGTCCCTTAGTTTGAATCCATAAATGTCCTTCGGTTTCAAGTTTCTTTTAAAAAAAAAA
page-top