Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1m12
Contig Information
Length 468 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1m12   
Homology (BLAST) Top Hit hypothetical protein KAOT1_11206 [Kordia algicida OT-1] >gi|161324155|gb|EDP95487.1| hypothetical protein KAOT1_11206 [Kordia algicida OT-1]
Score 77
Evalue 3.56919
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>whem1m12
ATGCATATGTCAAAGAAAAAAATCCCTGGTTGTGGTGTGTCCATTATGATTATCCTTATACAGTGGGCACCACTACTTGCTGTCCGGATAAGCTTACTCC
TTAATACTACTCTACATTTAGGAATGCAGTGAGTATGTGGTGTTTTTTTCTGATGTGCAGAGTGGTGCAGTTGGATAGTTGTTCAAGATAATTTTGCCTG
AAGTTTTGATATATTTTTATATTTTGATATAATGTGAACTGCCCAAAAAATAGACAAATAGGAAAATTATATGGTCATTGGATGATCTGGTTAATTGTCA
TTCAAAGACATGAGATCGAAAGAATGTTTCCTTGATGTCCACTTTTAATGAGCTAATAATAATTATCTTTTGGCCTTGTTTTANTTGAACCGTGCATTGC
GCATTGCATTCAAGGTTATTANTTGTNTGGGATGAACATTCNATTTCTTTTCANGTCATTCCTNGATG
page-top