Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1m11
Contig Information
Length 233 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1m11   
Homology (BLAST) Top Hit hypothetical protein OsI_20913 [Oryza sativa Indica Group]
Score 291
Evalue 5.4403e-25
Total Hit Count 17
Registered year 2003
Contig Sequence     [ Download ]
>whem1m11
CGCGCGGGATGACGACCATCATCGACACCCTCCAGATGATGTCGGAGGCGGCTCCCGGTGGACTGGAGCGGACAGAGTGGTCGGAGGTCGTCGCGCTCGG
CGATGTGGTGTCCAGGCAGGCCACCGTCACTGGGATGGTCTGGAGAGGAGACTTGCCTGGTATGGAAACGCTCAANGAGAACATTGCTGCNTATTTCAAT
GTCCTGCACGGTTTCCTTTTNGCCTATCATGGA
page-top