Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhem20p05
Contig Information
Length 781 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem20p05   
Homology (BLAST) Top Hit DNA binding protein [Zea mays]
Score 254
Evalue 3.3575e-20
Total Hit Count 19
Registered year 2003
Contig Sequence     [ Download ]
>rwhem20p05
CACACCAAGTCCCAACTCTGGATAATGCTAATACCTTATTTGCACTACCTTATTGAATCACCAACGATAAAACAAATGAGTTCTCAAGGATGTGGCACAT
TTAAAAACATCTGTATCAGATGCTAACTAGTGCTCCACATTCCACTGACGAAGCAATGCAGATTATGACTAAGATGCATGAAGAAGACAACATAGAGAAA
CAAGACCACAGGAACAAATTAGAACCCTAGGATCCGAAATGGTACAGGGATGCACGAACAGCATCCAGAGCTACAAATAAAACACTAAACACCTCCGACT
GGTCGAGCATCAACAATGGCAGTGAGCTGAGGATGACCACCAGGTGCATATTCCCAAAGAATGAAGATCAGATCCACAGTTATTAGCCTTTCCAGAGTTA
TTCACCAAGTGATAGGGGCACAATTCCAAATGTGCTGCTCCTTTCCTGATGCATTCCTTGAAGGATTCTTGACGCGAATTCACAGCCACAAAAGAGTGGT
CTAGGAGTGGTTTGGAACTCACGAGAAAAAAAGGCTGAAAGAACTAAGTACGAAGAGGCCCAGAGACGGCGTCACGCCCAGAGTTGGGGTCTTTTTGTTT
CAAAGACATGCTTGCAAACTGCGAGTCAAGGTCTCTGCTGTTACTACGACCAAGAGTAGGAGGCTGTGGTGTCTGTTGCTGCTGCTGATACAATGACCTT
AGACGACCAATTTCCCGCTCAAACATCTCCTGTTGAACACGTTTAATTACTTGCTCCTGTGCTATACTCTCCNGCCTTTGC
page-top