Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhem6k15
Contig Information
Length 557 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem6k15   
Homology (BLAST) Top Hit hypothetical protein OsI_30542 [Oryza sativa Indica Group]
Score 412
Evalue 7.4336e-39
Total Hit Count 22
Registered year 2003
Contig Sequence     [ Download ]
>rwhem6k15
GATTTTTNCAGGTTGCAACAAGATTACAACATTTTCAGGAAGAATGTGGCTCCTACATGATCTACGTATATTATTTACCTATGAATGAGAAAGCAGGTCC
CATTTAATTTCTTTACAGAAGTGAACCATTTGTCTNGGTTTNTGTGCAGGNGTCCAAAATGAAGCACGGCGATCACATCATCGTCTCGAATTTCTCGAGC
TTCTNCACTCTTCGCATANATGCAACCAGAAATGCNAAGAAAATGCCNGCGCCGACGAAAGACCCATTNGCGACTATTNGGTTTCCTTGACTACCCATGA
CGACCCCAATATGCNAGAGAGTACCACCCATGGCTGTATACATGGTCACCATCTGAAGNACGTTNGCTTNACGAGCAGCCCGTTCCGACTCNNGTACTCT
GACTCTGAGTTTCAGATCACCCGACTCNNGTTGCCCCACAAAATCCTCAATCCGNTGGATTCTGTAGGGCATTGAGATCGTANAATCNCGGGCATCATTT
GCTTGCTTTCTTATCTCCTGGACTAGNTCAGGTCCAGCTCTTCGTCTTGTTTTCAAG
page-top