Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1m05
Contig Information
Length 445 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1m05   
Homology (BLAST) Top Hit Os04g0464500 [Oryza sativa (japonica cultivar-group)] >gi|113564589|dbj|BAF14932.1| Os04g0464500 [Oryza sativa (japonica cultivar-group)]
Score 362
Evalue 3.11005e-33
Total Hit Count 72
Registered year 2003
Contig Sequence     [ Download ]
>whem1m05
ACCCTACCGCGAACACGTCGGCGATGAGCTCCTCCAACGGCAACGGCGGGAAGAAGCCGGCACCGTCCGGCGGGCGCGGGGGCATCCGCACCCTCGCCGA
CATCAACCGCGGCCCCTCCGGGTTCCCAGGCGCAGGCGGCAGCGGCAGCGACTCCGATGAGCCCCAGGAGTACTACACCGGCGGCGAGAAGAGTGGGATG
CTTGTTCAAGATCCAACAAGGAGAAATAATGTGGACTCAATCTTTGAGCAAGCTAGAGTGATGGGTGCTCAGCAAGTTCCACTGCCTTCTTTTGAAGGCC
AATCTTCCAGCTCAACCAGCTTTGCAGGAACAGGTCGTCTGCTTTCANGGGATGCGCAGACAGCACCAGCTGCTCCTCAACCACCGCAGGATGTTCTTCA
CAATATACATTTCTGGAACAATGGTTTCACAGTACATGATGGTCC
page-top