Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1m02
Contig Information
Length 246 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1m02   
Homology (BLAST) Top Hit OSJNBa0068L06.9 [Oryza sativa (japonica cultivar-group)] >gi|116317777|emb|CAH65755.1| OSIGBa0123D13.4 [Oryza sativa (indica cultivar-group)] >gi|125546927|gb|EAY92749.1| hypothetical protein OsI_14504 [Oryza sativa Indica Group] >gi|125589074|gb|EAZ29424.1| hypothetical protein OsJ_012907 [Oryza sativa (japonica cultivar-group)] >gi|215697911|dbj|BAG92153.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737534|dbj|BAG96664.1| unnamed protein product [Oryza sativa Japonica Group]
Score 285
Evalue 2.65442e-24
Total Hit Count 15
Registered year 2003
Contig Sequence     [ Download ]
>whem1m02
GCAAAGGAAGCTAGGGACAGCCGCCTATTTGGGCCGGTCCCTATGACTGATATTGTTGGGAGAGTTATATACTCTTTAAGAACTGCTGTTGATCATGGCC
CAGTGGACAACAGCCGTGTAGCCATGTTCCAGGATTTGCCGGTTTTGGCGGTAGAGCTCGACGTGGAAGAGATGGTGAAGAACAATAAAATGTAGATAAT
GACATCCTGTGGTGTGGTGNATCATTTCCTTTGTGCNGATTCTTCA
page-top